DesignPrimers 1.0

A tool for automated PCR primer design using Primer3 and SciRoKo 3.4

Download here

How to design PCR primer pairs:

1. Identify the microsatellites with SciRoKo

2. Select a subset of your microsatellites for which primer pairs should be designed using the interactive and flexible statistics module of SciRoKo. You may choose for example to design primer pairs solely for di - tetranucleotide microsatellites or even only for compound microsatellites

3. Extract the flanking sequences of the microsatellites with SciRoKo

4. Download the executable version of Primer3

5. Install perl on your computer and set the environment variables of your OS such that the perl executable can be found when using the console prompt.

5. Use the perl-script DesignPrimer

How to use DesignPrimer:

Upon download of DesignPrimer extract the archive into a folder, which should now contain the two files: DesignPrimer.pl and DesignPrimerInput.txt

First edit the file DesignPrimerInput.txt!

This file contains the settings which will be used by DesignPrimer as well as the location of the Primer3 executable, the location of the input and the output files!!
Explanations are marked with an '#' and added to each feature directly in the file.

1. Edit the DesignPrimerInput.txt file

2. Specify the path where the primer3 executable can be found: primer3_core.exe -> this is an obligatory parameter

3. Specify the path where the input file can be found -> this is an obligatory parameter

4. Change other settings or if uncertain leave the default settings. Default output is the file results.txt. Save the edits.

5. Enter the command prompt (Linux console, MS Dos) and type:
perl DesignPrimers.pl

6. Admire the results

Which input file is accepted by DesignPrimer:

Valid DesignPrimer input files are automatically created with SciRoKo 3.4!

The input file has to be a multiple fasta file i.e a fasta file containing many several individual records.

The fasta header has to contain the fields:
Startpos_here=
Length=

' Startpos_here=' specifies the start position of the microsatellite within the extracted flanking sequence (Warning: not in the original sequence)
' Length=' specifies the length of the microsatellite.
This two fields specify the TARGET region for Primer3!

The field 'Startpos_in_parent=' is not necessary, it refers to the startposition of the microsatellite in the sequence which was initially used for microsatellite search. In the following example the microsatellite TTTTTTTTTTTTTTTTTT is found in Arabidopsis chromosome 5 at position 363 bp from the 5' end.

>CHR5v01212004 Startpos_in_parent=363 Startpos_here=201 Length=18
GTGACGTAAGTGTTTAGACTAGAGCCGGCCGTGAGCACAAGCGGGCCAAG
CCCATGCTTGCGGCAGATTATCCTATAATTATGTTTTGCGGCTTTACAAT
TTTGAATTTGTTTTGTTGTTTAGTGGTCGAGTCAGGGATGAGTTTGTTCT
CAAACATCTCAAATTTCTAATCTTCCAAGTGTTAGGTTCACTCTACCTTA
TTTTTTTTTTTTTTTTTTATTTTAAATTTCTATTAGAAAGAACTTGAACC
TTATTTCAAGTGAACATTAAAAAGAATTGTAACCCTACCTTATTTCTATT
ATTATGAATATGTGTAAAGTAAATTTTTTTACAATAAGCATGTATAAAGT
AACATATTTTTGTTCTTTTCTTATAGCCTTGTAAATCATAGGGACGGATC
TAGTTTAGAATAAAGTGT

Download a valid example input file

Which output is generated with DesignPrimer

DesignPrimer allows to select one of two detail levels for the output file:

In full-detail mode (set flag DETAIL_LEVEL=1) DesignPrimer generates the following outptut for each PCR primer pair: The output is in tab-delimited and occupies only a single line (the following example occupies multiple line simple because of space issues)

AMS1_fwd CCCAGTCACGACGTTGTCTTCCAAGTGTTAGGTTCACTC AMS1_rev TCCGTCCCTATGATTTACAAGG TM_left: 57.533 TM_right: 60.197 PCR_product_size: 228 Full_fasta_ID: CHR5v01212004 Startpos_in_parent=363 Startpos_here=201 Length=18

In basic-detail mode (set flag DETAIL_LEVEL=0) DesignPrimer reports only the four first columns. This files can be directly sent to a companie for synthesis of the primer pairs.

AMS1_fwd CCCAGTCACGACGTTGTCTTCCAAGTGTTAGGTTCACTC AMS1_rev TCCGTCCCTATGATTTACAAGG