PanGEA-SW can be used to create pairwise sequence alignments using either the normal Smith-Waterman algorithm or the homopolymer Smith-Waterman algorithm. The pairwise alignments may be used for SNP identification with PanGEA-SNP
A database sequence will be aligned with all subsequent query sequences.
(See input file below)
Minimum commands in Windows:
PanGEA-Sw -i input.txt
Minimum commands in Linux (Mono):
mono PanGEA-Sw.exe -i input.txt
Following, for sake of simplicity, only the windows commands are shown, the Linux commands have to be adjusted as shown above:.
If no output file has been specified the default output file "result.aln" is used.
Multiple input files may be specified
PanGEA-Sw -i input1.txt -i input2.txt -o alignments.aln
The penalties and the hit score may be specified
PanGEA-Sw -i input.txt -pi 11 -hit 3 -pe 3 -pmm 6
The unmodified Smith-Waterman algorithm may be used instead of the homopolymer SW algorithm, by raising the '-normalsw' flag.
PanGEA-Sw -i input.txt -normalsw
Display the help
PanGEA-Sw
Description of all parameters:
Obligatory parameters: |
|
| -i | input file; obligatory parameter |
Optional parameters: |
|
| -o | output file; optional paramter; default: result.aln |
| -pi | gap introducing penalty; optional parameter; default: 11 |
| -pe | gap extend penalty; optional parameter; default: 2 |
| -pt | homopolymere transgression penalty; optional parameter; default: 3 |
| -pmm | mismatch penalty; optional parameter; default: 5 |
| -hit | score for a hit; optional parameter; default: 3 |
| -normalsw | the normal Smith-Waterman algorithm will be used instead of the homopolymer SW optional parameter; default: off |
The input file has to be a slightly modified multiple fasta file, in which two types of sequences are distinguised: database sequences and query sequences. The fasta identifier of the database sequences has to be '>>' whereas for the query sequences the common fasta identifier '>' is used. A database sequence will be aligned with all of the following query sequences until a new database sequence is encountered. download example input
Example:
>>data1
AAATTGCAATT
>query1.1
AAATT
>query1.2
TTGC
>>data2
TTCGTCTCTCTCGAAGAGAGTC
>query2.1
CGTCT
>query2.2
GAAGAG
Output is a PanGEA-BlastN pairwise alignment format. The output of PanGEA-SW may be used for SNP identification using PanGEA-SNP
