PanGEA-SNP can be used to identify SNPs from a set of pairwise alignments which have been created with PanGEA-BlastN.
The pairwise alignments may map to different sequences and/or positions within these sequences. The number of pairwise alignments which can be analysed at once is not limited.
Minimum commands in Windows:
PanGEA-SNP -i alignments.aln
Minimum commands in Linux (Mono):
mono PanGEA-SNP.exe -i alignments.aln
Following, for sake of simplicity, only the windows commands are shown, the Linux commands have to be adjusted as shown above:.
If no output file has been specified the default output file "result.snp" is used.
Multiple input files may be specified
PanGEA-SNP -i alignments1.aln -i alignments2.aln -o snps.snp
Files containing the sequence quality of the ESTs may be specified
PanGEA-SNP -i alignments1.aln -i alignments2.aln -q quality1.qul -q quality2.qul -q quality3.qul -o snps_with_quality.snp
The minimum and the maximum number of alleles may be specified
PanGEA-SNP -i alignments.aln -minAllele 2 -maxAllele 2 -o results.snp
Whether indels should be considered as valid SNP allele may be specified PanGEA-SNP -i alignments.aln -useIndels yes -o results.snp
Whether the 454-adapted "ad hoc" solution to estimate the reliability of the SNP should be used may be specified (see publication)
PanGEA-SNP -i alignments.aln -use454 yes -o results.snp
Display the help
PanGEA-SNP
Description of all parameters:
Obligatory parameters: |
|
| -i | input file(s); PanGEA-BlastN pairwise alignments; obligatory parameter |
Optional parameters: |
|
| -o | output file; optional paramter; default: result.snp |
| -q | quality file(s) for ESTs; *.qul, *.qual; optional parameter |
| -minAllele | minimum number of alleles at a SNP site; optional parameter; default: 2 |
| -maxAllele | maximum number of alleles at a SNP site; optional parameter; default: 5 |
| -mafp | minimum frequency of allele at SNP site in percent; optional parameter; default: 1.5 |
| -mafc | minimum frequency of allele at SNP site in counts; optional parameter; default: 2 |
| -mc | minimum coverage of SNP site, i.e ESTs mapping to the SNP site; optional parameter; default 4 |
| -na |
neighborhood of SNP in alignments, for counting low-alignment-quality tokens;default parameter; default: 15 (bp) |
| -ns | neighborhood of SNPs for assessing the sequence-quality in the neighborhood of SnP; default parameter; default: 7 (bp) |
| -useIndels [yes/no] | consider indels as valid SNP allele; optional parameter; default: no |
| -use454 [yes/no] | use the 454-adapted ad-hoc solution for assessing the alignment-quality in the neighborhood of the SNP; optional parameter; default: no |
The input files have to be valid PanGEA-BlastN or PanGEA-SW output files. The ESTs (sequences) may map to any gene/chromosome at any position. Multiple files can be specified
example alignment input:
>>
dbName: Gene_number_one
queName: EST_a
subAlgn: 2
strand: +/+
dbLength: 607
queLength: 240
summary: 25 528 1 239 713.90 100.00 1
> 25 149 1 125 375.00 100.00 0
AAATCAAGTGAATCATCTCAGTGCAACTAAAGGCCTAAATAGCCCATACCTACCTTTTTTGTAAACAAGT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AAATCAAGTGAATCATCTCAGTGCAACTAAAGGCCTAAATAGCCCATACCTACCTTTTTTGTAAACAAGT
GAACAAGTTCGAGGAAATACAACTCAATCAAGATGCCTTGCCCATGCGGAAGCGG
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
GAACAAGTTCGAGGAAATACAACTCAATCAAGATGCCTTGCCCATGCGGAAGCGG
<
> 414 528 126 239 338.90 100.00 1
ATGCAAATGCGCCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGCGGCGGCGAC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATGCAAATGCGCCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGCGGCGGCGAC
AAGAAATCCGCCTGCGGCTGCTCCGAGTGAGCTTTCCCCCAAAAA
||||||||||||||||||||||||||||||||||||||| |||||
AAGAAATCCGCCTGCGGCTGCTCCGAGTGAGCTTTCCCC-AAAAA
<
<<
The quality files have to be the common mulitple fasta-like files. Make sure that the quality files are of the same length as the original ESTs used for PanGEA-BlastN search, otherwise errors or wrong quality estimates will result. Furthermore the quality file has to exist for each EST, otherwise again an error will result
>example_quality_file
34 28 28 27 27 28 23 33 25 26 35 28 27 27 28 28 34 27 27 28 26 27 32 25 26 28 27 34 27 27 27 28 28 27 27 27 27 26 28 35 28 34 28 27 37 33 17 27 27 33
25 28 34 27 28 33 25 28 28 34 27 34 27 25 27 27 27 27 27 27 34 27 28 34 27 27 38 34 22 9 28 28 27 27 27 28 34 28 25 27 27 27 28 33 26 28 28 27 28 28
27 28 27 28 33 26 28 28 27 26 28 27 24 28 28 38 34 22 10 27 25 28 28 27 37 33 15 28 27 27 37 33 16 27 27 27 28 27 27 28 27 27 37 33 16 28 27 26 23 26
33 26 25 32 24 27 35 31 12 35 28 27 27 34 28 26 32 24 36 32 13 31 24 21 31 23 27 35 31 11 28 31 26 3 27 28 25 38 34 24 16 9 2 27 27 23 24 24 28 37
33 20 6 21 20 35 30 11 27 28 37 33 16 27 37 33 16 26 33 26 36 32 13 37 33 16 20 27 27 21 37 33 17 20 23 37 32 14 37 33 15 27 27 18 27 27 37 33 16 18
26 34 28 37 33 15 25 20 28 26 18 25 32 24 21
