You may either export the pairwise alignments, or the sequence of the database sequences or the sequence of the query sequences. Additionally, you may choose whether to export the entire subset or only a fraction of the subset. In this case you have to specify the IDs of the database sequences for which the selected feature should be exported.
The nucleotide sequences of the query sequences may be exported from the pairwise alignments. It is of course only possible to export the fraction of the query sequence which is contained in the pairwise alignment. At this point, the whole query sequence is not available any more.
The nucleotide sequences of the database sequences may be exported from the pairwise alignments. It is of course only possible to export the fraction of the database sequence which is contained in the pairwise alignment. The whole sequence is not available any more. In case the alignments contain several partial alignments which are separated by long gaps, PanGEA inserts a series of 10 x 'N' at the position of the gaps.
>xylophon-transferase
CCGGCATATCCTGCTGATCCTGTGCCCGTCTCACCCACCACCGGCCCCGT
CGTCACCAGCCACATCCAAAAGGTCAAGCCGCCCAAGAAGTACTCGCTGA
TCAACCAAGATNNNNNNNNNNGCAAGGAGCGAGGCCAAGGTGGTCCAGGC
CCACAAGTACAAGTCCGTCCAGCGACCCCAGGCCGTGAACAATCGCTTCC
TGGCGCCCCAGGCCCAATGACCCGTGGGCCTGGCCCTCGAT